shp53 plo1 pure godar (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
shp53 plo1 pure godar
Shp53 Plo1 Pure Godar, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 94 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shp53+plo1+pure+godar/shp53+pLKO%2E1+puro+(Plasmid+%2319119)/bernard_matthew_james__2025__an_unexpected_role_of_the_tricarboxylic_acid_cycle_enzyme_oxoglutarate_dehydrogenase_like_as_a-939-60-66
Average 93 stars, based on 94 article reviews
Shp53 Plo1 Pure Godar, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 94 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shp53+plo1+pure+godar/shp53+pLKO%2E1+puro+(Plasmid+%2319119)/bernard_matthew_james__2025__an_unexpected_role_of_the_tricarboxylic_acid_cycle_enzyme_oxoglutarate_dehydrogenase_like_as_a-939-60-66
Average 93 stars, based on 94 article reviews
shp53 plo1 pure godar - by Bioz Stars,
2026-09
93/100 stars
Images
Related Articles
Chromatin Immunoprecipitation:Article Title: Defining the Role of Metabolism in Prostate Epithelial Cell Fate and Response to Androgen Receptor Blockade Article Snippet: Previously published ChIP sequencing data that was reanalyzed here is available under accession number GSE138460. d Code for generating PCA projection plots can be found at https://github.com/Nick-Nunley/PCA-for-AR-induced-metabolicreprogramming-in-CRPCa Continued REAGENT or RESOURCE SOURCE IDENTIFIER 5’-AAAAGAATTCTTCC ATAGAGCTCGCTCTTGACGAG CTCTATGGAAGAATTC-3’ This paper N/A F-50- AGTTGAGTTTTAGTGATT TTGTGGT -30 This paper N/A R-50- AACTTACCTTCTACACTT AATCATAATTAA -30 This paper N/A Recombinant DNA pBluescript II KS(+) Stratagene Cat#212207 shp53 pLO1 pure Godar et al.66 Addgene Cat#19119 pENTR/U6 vector Thermo Fisher Scientific Cat#K4945-00 Software and algorithms DeepTools program suite Ramirez et al.67 https://deeptools.readthedocs.io/en/ develop/index.html Trim Galore version 0.6.6 N/A https://github.com/FelixKrueger/TrimGalore Bismark version 0.23.0 Krueger et al.68 https://www.bioinformatics.babraham.ac.uk/ projects/bismark/ Principal component analysis projection plots This paper https://github.com/Nick-Nunley/PCA-for- AR-induced-metabolic-reprogrammingin-CRPCa Metaboanalyst 5.0 Pang et al.69 https://www.metaboanalyst.ca/ MetaboAnalyst/home.xhtml ImageJ v1.53c ImageJ https://imagej.nih.gov/ij/download.html CellProfiler v2.0 Kamentsky et al.70 https://cellprofiler.org/ Imaris software Oxford Instruments https://imaris.oxinst.com/ DAVID Bioinformatics Huang et al.,71 Huang et al.72 https://david.ncifcrf.gov/ GSEA_4.0.3 Subramanian et al.,73 Mootha et al.74 https://www.gsea-msigdb.org/ gsea/index.jsp STAR aligner version 2.5.0b Dobin et al.75 N/A Prism v8 GraphPad https://www.graphpad.com/scientific- software/prism/ Other Sonic dismembrator Thermo Fisher Scientific Cat#FB120 Cell Reports 42, 113221, October 31, 2023 21 Article ll OPEN ACCESS 131 d Any additional information required to reanalyze the data reported in this work paper is available from the lead contact upon request. .. Previously published ChIP sequencing data that was reanalyzed here is available under accession number GSE138460. d Code for generating PCA projection plots can be found at https://github.com/Nick-Nunley/PCA-for-AR-induced-metabolicreprogramming-in-CRPCa Continued REAGENT or RESOURCE SOURCE IDENTIFIER 5’-AAAAGAATTCTTCC ATAGAGCTCGCTCTTGACGAG CTCTATGGAAGAATTC-3’ This paper N/A F-50- AGTTGAGTTTTAGTGATT TTGTGGT -30 This paper N/A R-50- AACTTACCTTCTACACTT AATCATAATTAA -30 This paper N/A Recombinant DNA pBluescript II KS(+) Stratagene Cat#212207 Article Title: An unexpected role of the Tricarboxylic Acid Cycle enzyme Oxoglutarate Dehydrogenase-Like as a regulator of proliferation and nucleotide metabolism in prostate cancer Article Snippet: .. Previously published ChIP sequencing data that was reanalyzed here is available under accession number GSE138460. d Code for generating PCA projection plots can be found at https://github.com/Nick-Nunley/PCA-for-AR-induced-metabolicreprogramming-in-CRPCa Continued REAGENT or RESOURCE SOURCE IDENTIFIER 5’-AAAAGAATTCTTCC ATAGAGCTCGCTCTTGACGAG CTCTATGGAAGAATTC-3’ This paper N/A F-50- AGTTGAGTTTTAGTGATT TTGTGGT -30 This paper N/A R-50- AACTTACCTTCTACACTT AATCATAATTAA -30 This paper N/A Recombinant DNA pBluescript II KS(+) Stratagene Cat#212207 Sequencing:Article Title: Defining the Role of Metabolism in Prostate Epithelial Cell Fate and Response to Androgen Receptor Blockade Article Snippet: Previously published ChIP sequencing data that was reanalyzed here is available under accession number GSE138460. d Code for generating PCA projection plots can be found at https://github.com/Nick-Nunley/PCA-for-AR-induced-metabolicreprogramming-in-CRPCa Continued REAGENT or RESOURCE SOURCE IDENTIFIER 5’-AAAAGAATTCTTCC ATAGAGCTCGCTCTTGACGAG CTCTATGGAAGAATTC-3’ This paper N/A F-50- AGTTGAGTTTTAGTGATT TTGTGGT -30 This paper N/A R-50- AACTTACCTTCTACACTT AATCATAATTAA -30 This paper N/A Recombinant DNA pBluescript II KS(+) Stratagene Cat#212207 shp53 pLO1 pure Godar et al.66 Addgene Cat#19119 pENTR/U6 vector Thermo Fisher Scientific Cat#K4945-00 Software and algorithms DeepTools program suite Ramirez et al.67 https://deeptools.readthedocs.io/en/ develop/index.html Trim Galore version 0.6.6 N/A https://github.com/FelixKrueger/TrimGalore Bismark version 0.23.0 Krueger et al.68 https://www.bioinformatics.babraham.ac.uk/ projects/bismark/ Principal component analysis projection plots This paper https://github.com/Nick-Nunley/PCA-for- AR-induced-metabolic-reprogrammingin-CRPCa Metaboanalyst 5.0 Pang et al.69 https://www.metaboanalyst.ca/ MetaboAnalyst/home.xhtml ImageJ v1.53c ImageJ https://imagej.nih.gov/ij/download.html CellProfiler v2.0 Kamentsky et al.70 https://cellprofiler.org/ Imaris software Oxford Instruments https://imaris.oxinst.com/ DAVID Bioinformatics Huang et al.,71 Huang et al.72 https://david.ncifcrf.gov/ GSEA_4.0.3 Subramanian et al.,73 Mootha et al.74 https://www.gsea-msigdb.org/ gsea/index.jsp STAR aligner version 2.5.0b Dobin et al.75 N/A Prism v8 GraphPad https://www.graphpad.com/scientific- software/prism/ Other Sonic dismembrator Thermo Fisher Scientific Cat#FB120 Cell Reports 42, 113221, October 31, 2023 21 Article ll OPEN ACCESS 131 d Any additional information required to reanalyze the data reported in this work paper is available from the lead contact upon request. .. Previously published ChIP sequencing data that was reanalyzed here is available under accession number GSE138460. d Code for generating PCA projection plots can be found at https://github.com/Nick-Nunley/PCA-for-AR-induced-metabolicreprogramming-in-CRPCa Continued REAGENT or RESOURCE SOURCE IDENTIFIER 5’-AAAAGAATTCTTCC ATAGAGCTCGCTCTTGACGAG CTCTATGGAAGAATTC-3’ This paper N/A F-50- AGTTGAGTTTTAGTGATT TTGTGGT -30 This paper N/A R-50- AACTTACCTTCTACACTT AATCATAATTAA -30 This paper N/A Recombinant DNA pBluescript II KS(+) Stratagene Cat#212207 Article Title: An unexpected role of the Tricarboxylic Acid Cycle enzyme Oxoglutarate Dehydrogenase-Like as a regulator of proliferation and nucleotide metabolism in prostate cancer Article Snippet: .. Previously published ChIP sequencing data that was reanalyzed here is available under accession number GSE138460. d Code for generating PCA projection plots can be found at https://github.com/Nick-Nunley/PCA-for-AR-induced-metabolicreprogramming-in-CRPCa Continued REAGENT or RESOURCE SOURCE IDENTIFIER 5’-AAAAGAATTCTTCC ATAGAGCTCGCTCTTGACGAG CTCTATGGAAGAATTC-3’ This paper N/A F-50- AGTTGAGTTTTAGTGATT TTGTGGT -30 This paper N/A R-50- AACTTACCTTCTACACTT AATCATAATTAA -30 This paper N/A Recombinant DNA pBluescript II KS(+) Stratagene Cat#212207 Recombinant:Article Title: Defining the Role of Metabolism in Prostate Epithelial Cell Fate and Response to Androgen Receptor Blockade Article Snippet: Previously published ChIP sequencing data that was reanalyzed here is available under accession number GSE138460. d Code for generating PCA projection plots can be found at https://github.com/Nick-Nunley/PCA-for-AR-induced-metabolicreprogramming-in-CRPCa Continued REAGENT or RESOURCE SOURCE IDENTIFIER 5’-AAAAGAATTCTTCC ATAGAGCTCGCTCTTGACGAG CTCTATGGAAGAATTC-3’ This paper N/A F-50- AGTTGAGTTTTAGTGATT TTGTGGT -30 This paper N/A R-50- AACTTACCTTCTACACTT AATCATAATTAA -30 This paper N/A Recombinant DNA pBluescript II KS(+) Stratagene Cat#212207 shp53 pLO1 pure Godar et al.66 Addgene Cat#19119 pENTR/U6 vector Thermo Fisher Scientific Cat#K4945-00 Software and algorithms DeepTools program suite Ramirez et al.67 https://deeptools.readthedocs.io/en/ develop/index.html Trim Galore version 0.6.6 N/A https://github.com/FelixKrueger/TrimGalore Bismark version 0.23.0 Krueger et al.68 https://www.bioinformatics.babraham.ac.uk/ projects/bismark/ Principal component analysis projection plots This paper https://github.com/Nick-Nunley/PCA-for- AR-induced-metabolic-reprogrammingin-CRPCa Metaboanalyst 5.0 Pang et al.69 https://www.metaboanalyst.ca/ MetaboAnalyst/home.xhtml ImageJ v1.53c ImageJ https://imagej.nih.gov/ij/download.html CellProfiler v2.0 Kamentsky et al.70 https://cellprofiler.org/ Imaris software Oxford Instruments https://imaris.oxinst.com/ DAVID Bioinformatics Huang et al.,71 Huang et al.72 https://david.ncifcrf.gov/ GSEA_4.0.3 Subramanian et al.,73 Mootha et al.74 https://www.gsea-msigdb.org/ gsea/index.jsp STAR aligner version 2.5.0b Dobin et al.75 N/A Prism v8 GraphPad https://www.graphpad.com/scientific- software/prism/ Other Sonic dismembrator Thermo Fisher Scientific Cat#FB120 Cell Reports 42, 113221, October 31, 2023 21 Article ll OPEN ACCESS 131 d Any additional information required to reanalyze the data reported in this work paper is available from the lead contact upon request. .. Previously published ChIP sequencing data that was reanalyzed here is available under accession number GSE138460. d Code for generating PCA projection plots can be found at https://github.com/Nick-Nunley/PCA-for-AR-induced-metabolicreprogramming-in-CRPCa Continued REAGENT or RESOURCE SOURCE IDENTIFIER 5’-AAAAGAATTCTTCC ATAGAGCTCGCTCTTGACGAG CTCTATGGAAGAATTC-3’ This paper N/A F-50- AGTTGAGTTTTAGTGATT TTGTGGT -30 This paper N/A R-50- AACTTACCTTCTACACTT AATCATAATTAA -30 This paper N/A Recombinant DNA pBluescript II KS(+) Stratagene Cat#212207 Article Title: An unexpected role of the Tricarboxylic Acid Cycle enzyme Oxoglutarate Dehydrogenase-Like as a regulator of proliferation and nucleotide metabolism in prostate cancer Article Snippet: .. Previously published ChIP sequencing data that was reanalyzed here is available under accession number GSE138460. d Code for generating PCA projection plots can be found at https://github.com/Nick-Nunley/PCA-for-AR-induced-metabolicreprogramming-in-CRPCa Continued REAGENT or RESOURCE SOURCE IDENTIFIER 5’-AAAAGAATTCTTCC ATAGAGCTCGCTCTTGACGAG CTCTATGGAAGAATTC-3’ This paper N/A F-50- AGTTGAGTTTTAGTGATT TTGTGGT -30 This paper N/A R-50- AACTTACCTTCTACACTT AATCATAATTAA -30 This paper N/A Recombinant DNA pBluescript II KS(+) Stratagene Cat#212207 Article Title: MYC is a regulator of androgen receptor inhibition-induced metabolic requirements in prostate cancer. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Raw and processed RNAseq (LNCaP Castration vs Enzalutamide) This paper GEO: GSE202755 Raw and processed RNAseq (16D Enzalutamide-treated cells transduced with cMyc, shRb1, shTp53, or shRb1_shTp53) This paper GEO: GSE202897 Raw and processed ChIP-seq (16D AR ChIP) Davies et al.30 GEO: GSE138460 Raw metabolomics data (In vivo 16D vehicle and Enzalutamide tumors) This paper NMDR: ST002852 Raw metabolomics data (In vitro 16D vehicle and Enzalutamide replicate 1 for Figure 2I) This paper NMDR: ST002859 Raw metabolomics data (In vitro 16D vehicle and Enzalutamide replicates 2 and 3 for Figure 2I) This paper NMDR: ST002860 Raw metabolomics data (In vitro 16D validation of IACS-010759) This paper NMDR: ST002856 Raw metabolomics data (In vitro 16D vehicle and Enzalutamide for Figures S1FS-H) This paper NMDR: ST002863 Raw metabolomics data (In vitro 16D Enzalutamide, Apalutamide, ARCC-4) This paper NMDR: ST002865 Raw metabolomics data (In vitro 16D -/+ MYC -/+ Enza) This paper NMDR: ST002864 Experimental models: Cell lines LNCaP ATCC CRL-1740 V16D Bishop et al.19 N/A LAPC4 Klein et al.65 N/A 22Rv1 ATCC CRL-2505 Experimental models: Organisms/strains Mouse: NSG Jackson Laboratories and the UCLA Department of Radiation Oncology Animal Core Facility Cat#005557 Oligonucleotides 5’-AATTCTTTAATTAAAG-3’ This paper N/A 5’-CCTTAATTAAGCGATC GCACTGGGTACCTGGGCC-3’ This paper N/A 5’-CAGGTACCCAGTG CGATCGCTTAATTAAGGGTAC-3’ This paper N/A 5’-CTTAATTAAACTGGGGAGC TCCGC-3’ This paper N/A 5’-GGAGCTCCCCAGTTTAATT AAGAGCT-3’ This paper N/A 5’-GACGATGATTAATTAA-3’ This paper N/A 5’-CACCGAATTCTTCC ATAGAGCTCGTCAAGAGCGA GCTCTATGGAAGAATTC-3’ This paper N/A (Continued on next page) 20 Cell Reports 42, 113221, October 31, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER 5’-AAAAGAATTCTTCC ATAGAGCTCGCTCTTGACGAG CTCTATGGAAGAATTC-3’ This paper N/A F-50- AGTTGAGTTTTAGTGATT TTGTGGT -30 This paper N/A R-50- AACTTACCTTCTACACTT AATCATAATTAA -30 This paper N/A Recombinant DNA pBluescript II KS(+) Stratagene Cat#212207 Plasmid Preparation:Article Title: Defining the Role of Metabolism in Prostate Epithelial Cell Fate and Response to Androgen Receptor Blockade Article Snippet: Previously published ChIP sequencing data that was reanalyzed here is available under accession number GSE138460. d Code for generating PCA projection plots can be found at https://github.com/Nick-Nunley/PCA-for-AR-induced-metabolicreprogramming-in-CRPCa Continued REAGENT or RESOURCE SOURCE IDENTIFIER 5’-AAAAGAATTCTTCC ATAGAGCTCGCTCTTGACGAG CTCTATGGAAGAATTC-3’ This paper N/A F-50- AGTTGAGTTTTAGTGATT TTGTGGT -30 This paper N/A R-50- AACTTACCTTCTACACTT AATCATAATTAA -30 This paper N/A Recombinant DNA pBluescript II KS(+) Stratagene Cat#212207 shp53 pLO1 pure Godar et al.66 Addgene Cat#19119 pENTR/U6 vector Thermo Fisher Scientific Cat#K4945-00 Software and algorithms DeepTools program suite Ramirez et al.67 https://deeptools.readthedocs.io/en/ develop/index.html Trim Galore version 0.6.6 N/A https://github.com/FelixKrueger/TrimGalore Bismark version 0.23.0 Krueger et al.68 https://www.bioinformatics.babraham.ac.uk/ projects/bismark/ Principal component analysis projection plots This paper https://github.com/Nick-Nunley/PCA-for- AR-induced-metabolic-reprogrammingin-CRPCa Metaboanalyst 5.0 Pang et al.69 https://www.metaboanalyst.ca/ MetaboAnalyst/home.xhtml ImageJ v1.53c ImageJ https://imagej.nih.gov/ij/download.html CellProfiler v2.0 Kamentsky et al.70 https://cellprofiler.org/ Imaris software Oxford Instruments https://imaris.oxinst.com/ DAVID Bioinformatics Huang et al.,71 Huang et al.72 https://david.ncifcrf.gov/ GSEA_4.0.3 Subramanian et al.,73 Mootha et al.74 https://www.gsea-msigdb.org/ gsea/index.jsp STAR aligner version 2.5.0b Dobin et al.75 N/A Prism v8 GraphPad https://www.graphpad.com/scientific- software/prism/ Other Sonic dismembrator Thermo Fisher Scientific Cat#FB120 Cell Reports 42, 113221, October 31, 2023 21 Article ll OPEN ACCESS 131 d Any additional information required to reanalyze the data reported in this work paper is available from the lead contact upon request. .. Previously published ChIP sequencing data that was reanalyzed here is available under accession number GSE138460. d Code for generating PCA projection plots can be found at https://github.com/Nick-Nunley/PCA-for-AR-induced-metabolicreprogramming-in-CRPCa Continued REAGENT or RESOURCE SOURCE IDENTIFIER 5’-AAAAGAATTCTTCC ATAGAGCTCGCTCTTGACGAG CTCTATGGAAGAATTC-3’ This paper N/A F-50- AGTTGAGTTTTAGTGATT TTGTGGT -30 This paper N/A R-50- AACTTACCTTCTACACTT AATCATAATTAA -30 This paper N/A Recombinant DNA pBluescript II KS(+) Stratagene Cat#212207 Article Title: An unexpected role of the Tricarboxylic Acid Cycle enzyme Oxoglutarate Dehydrogenase-Like as a regulator of proliferation and nucleotide metabolism in prostate cancer Article Snippet: .. Previously published ChIP sequencing data that was reanalyzed here is available under accession number GSE138460. d Code for generating PCA projection plots can be found at https://github.com/Nick-Nunley/PCA-for-AR-induced-metabolicreprogramming-in-CRPCa Continued REAGENT or RESOURCE SOURCE IDENTIFIER 5’-AAAAGAATTCTTCC ATAGAGCTCGCTCTTGACGAG CTCTATGGAAGAATTC-3’ This paper N/A F-50- AGTTGAGTTTTAGTGATT TTGTGGT -30 This paper N/A R-50- AACTTACCTTCTACACTT AATCATAATTAA -30 This paper N/A Recombinant DNA pBluescript II KS(+) Stratagene Cat#212207 Article Title: MYC is a regulator of androgen receptor inhibition-induced metabolic requirements in prostate cancer. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Raw and processed RNAseq (LNCaP Castration vs Enzalutamide) This paper GEO: GSE202755 Raw and processed RNAseq (16D Enzalutamide-treated cells transduced with cMyc, shRb1, shTp53, or shRb1_shTp53) This paper GEO: GSE202897 Raw and processed ChIP-seq (16D AR ChIP) Davies et al.30 GEO: GSE138460 Raw metabolomics data (In vivo 16D vehicle and Enzalutamide tumors) This paper NMDR: ST002852 Raw metabolomics data (In vitro 16D vehicle and Enzalutamide replicate 1 for Figure 2I) This paper NMDR: ST002859 Raw metabolomics data (In vitro 16D vehicle and Enzalutamide replicates 2 and 3 for Figure 2I) This paper NMDR: ST002860 Raw metabolomics data (In vitro 16D validation of IACS-010759) This paper NMDR: ST002856 Raw metabolomics data (In vitro 16D vehicle and Enzalutamide for Figures S1FS-H) This paper NMDR: ST002863 Raw metabolomics data (In vitro 16D Enzalutamide, Apalutamide, ARCC-4) This paper NMDR: ST002865 Raw metabolomics data (In vitro 16D -/+ MYC -/+ Enza) This paper NMDR: ST002864 Experimental models: Cell lines LNCaP ATCC CRL-1740 V16D Bishop et al.19 N/A LAPC4 Klein et al.65 N/A 22Rv1 ATCC CRL-2505 Experimental models: Organisms/strains Mouse: NSG Jackson Laboratories and the UCLA Department of Radiation Oncology Animal Core Facility Cat#005557 Oligonucleotides 5’-AATTCTTTAATTAAAG-3’ This paper N/A 5’-CCTTAATTAAGCGATC GCACTGGGTACCTGGGCC-3’ This paper N/A 5’-CAGGTACCCAGTG CGATCGCTTAATTAAGGGTAC-3’ This paper N/A 5’-CTTAATTAAACTGGGGAGC TCCGC-3’ This paper N/A 5’-GGAGCTCCCCAGTTTAATT AAGAGCT-3’ This paper N/A 5’-GACGATGATTAATTAA-3’ This paper N/A 5’-CACCGAATTCTTCC ATAGAGCTCGTCAAGAGCGA GCTCTATGGAAGAATTC-3’ This paper N/A (Continued on next page) 20 Cell Reports 42, 113221, October 31, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER 5’-AAAAGAATTCTTCC ATAGAGCTCGCTCTTGACGAG CTCTATGGAAGAATTC-3’ This paper N/A F-50- AGTTGAGTTTTAGTGATT TTGTGGT -30 This paper N/A R-50- AACTTACCTTCTACACTT AATCATAATTAA -30 This paper N/A Recombinant DNA pBluescript II KS(+) Stratagene Cat#212207 Software:Article Title: Defining the Role of Metabolism in Prostate Epithelial Cell Fate and Response to Androgen Receptor Blockade Article Snippet: Previously published ChIP sequencing data that was reanalyzed here is available under accession number GSE138460. d Code for generating PCA projection plots can be found at https://github.com/Nick-Nunley/PCA-for-AR-induced-metabolicreprogramming-in-CRPCa Continued REAGENT or RESOURCE SOURCE IDENTIFIER 5’-AAAAGAATTCTTCC ATAGAGCTCGCTCTTGACGAG CTCTATGGAAGAATTC-3’ This paper N/A F-50- AGTTGAGTTTTAGTGATT TTGTGGT -30 This paper N/A R-50- AACTTACCTTCTACACTT AATCATAATTAA -30 This paper N/A Recombinant DNA pBluescript II KS(+) Stratagene Cat#212207 shp53 pLO1 pure Godar et al.66 Addgene Cat#19119 pENTR/U6 vector Thermo Fisher Scientific Cat#K4945-00 Software and algorithms DeepTools program suite Ramirez et al.67 https://deeptools.readthedocs.io/en/ develop/index.html Trim Galore version 0.6.6 N/A https://github.com/FelixKrueger/TrimGalore Bismark version 0.23.0 Krueger et al.68 https://www.bioinformatics.babraham.ac.uk/ projects/bismark/ Principal component analysis projection plots This paper https://github.com/Nick-Nunley/PCA-for- AR-induced-metabolic-reprogrammingin-CRPCa Metaboanalyst 5.0 Pang et al.69 https://www.metaboanalyst.ca/ MetaboAnalyst/home.xhtml ImageJ v1.53c ImageJ https://imagej.nih.gov/ij/download.html CellProfiler v2.0 Kamentsky et al.70 https://cellprofiler.org/ Imaris software Oxford Instruments https://imaris.oxinst.com/ DAVID Bioinformatics Huang et al.,71 Huang et al.72 https://david.ncifcrf.gov/ GSEA_4.0.3 Subramanian et al.,73 Mootha et al.74 https://www.gsea-msigdb.org/ gsea/index.jsp STAR aligner version 2.5.0b Dobin et al.75 N/A Prism v8 GraphPad https://www.graphpad.com/scientific- software/prism/ Other Sonic dismembrator Thermo Fisher Scientific Cat#FB120 Cell Reports 42, 113221, October 31, 2023 21 Article ll OPEN ACCESS 131 d Any additional information required to reanalyze the data reported in this work paper is available from the lead contact upon request. .. Previously published ChIP sequencing data that was reanalyzed here is available under accession number GSE138460. d Code for generating PCA projection plots can be found at https://github.com/Nick-Nunley/PCA-for-AR-induced-metabolicreprogramming-in-CRPCa Continued REAGENT or RESOURCE SOURCE IDENTIFIER 5’-AAAAGAATTCTTCC ATAGAGCTCGCTCTTGACGAG CTCTATGGAAGAATTC-3’ This paper N/A F-50- AGTTGAGTTTTAGTGATT TTGTGGT -30 This paper N/A R-50- AACTTACCTTCTACACTT AATCATAATTAA -30 This paper N/A Recombinant DNA pBluescript II KS(+) Stratagene Cat#212207 Article Title: An unexpected role of the Tricarboxylic Acid Cycle enzyme Oxoglutarate Dehydrogenase-Like as a regulator of proliferation and nucleotide metabolism in prostate cancer Article Snippet: .. Previously published ChIP sequencing data that was reanalyzed here is available under accession number GSE138460. d Code for generating PCA projection plots can be found at https://github.com/Nick-Nunley/PCA-for-AR-induced-metabolicreprogramming-in-CRPCa Continued REAGENT or RESOURCE SOURCE IDENTIFIER 5’-AAAAGAATTCTTCC ATAGAGCTCGCTCTTGACGAG CTCTATGGAAGAATTC-3’ This paper N/A F-50- AGTTGAGTTTTAGTGATT TTGTGGT -30 This paper N/A R-50- AACTTACCTTCTACACTT AATCATAATTAA -30 This paper N/A Recombinant DNA pBluescript II KS(+) Stratagene Cat#212207 Article Title: MYC is a regulator of androgen receptor inhibition-induced metabolic requirements in prostate cancer. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Raw and processed RNAseq (LNCaP Castration vs Enzalutamide) This paper GEO: GSE202755 Raw and processed RNAseq (16D Enzalutamide-treated cells transduced with cMyc, shRb1, shTp53, or shRb1_shTp53) This paper GEO: GSE202897 Raw and processed ChIP-seq (16D AR ChIP) Davies et al.30 GEO: GSE138460 Raw metabolomics data (In vivo 16D vehicle and Enzalutamide tumors) This paper NMDR: ST002852 Raw metabolomics data (In vitro 16D vehicle and Enzalutamide replicate 1 for Figure 2I) This paper NMDR: ST002859 Raw metabolomics data (In vitro 16D vehicle and Enzalutamide replicates 2 and 3 for Figure 2I) This paper NMDR: ST002860 Raw metabolomics data (In vitro 16D validation of IACS-010759) This paper NMDR: ST002856 Raw metabolomics data (In vitro 16D vehicle and Enzalutamide for Figures S1FS-H) This paper NMDR: ST002863 Raw metabolomics data (In vitro 16D Enzalutamide, Apalutamide, ARCC-4) This paper NMDR: ST002865 Raw metabolomics data (In vitro 16D -/+ MYC -/+ Enza) This paper NMDR: ST002864 Experimental models: Cell lines LNCaP ATCC CRL-1740 V16D Bishop et al.19 N/A LAPC4 Klein et al.65 N/A 22Rv1 ATCC CRL-2505 Experimental models: Organisms/strains Mouse: NSG Jackson Laboratories and the UCLA Department of Radiation Oncology Animal Core Facility Cat#005557 Oligonucleotides 5’-AATTCTTTAATTAAAG-3’ This paper N/A 5’-CCTTAATTAAGCGATC GCACTGGGTACCTGGGCC-3’ This paper N/A 5’-CAGGTACCCAGTG CGATCGCTTAATTAAGGGTAC-3’ This paper N/A 5’-CTTAATTAAACTGGGGAGC TCCGC-3’ This paper N/A 5’-GGAGCTCCCCAGTTTAATT AAGAGCT-3’ This paper N/A 5’-GACGATGATTAATTAA-3’ This paper N/A 5’-CACCGAATTCTTCC ATAGAGCTCGTCAAGAGCGA GCTCTATGGAAGAATTC-3’ This paper N/A (Continued on next page) 20 Cell Reports 42, 113221, October 31, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER 5’-AAAAGAATTCTTCC ATAGAGCTCGCTCTTGACGAG CTCTATGGAAGAATTC-3’ This paper N/A F-50- AGTTGAGTTTTAGTGATT TTGTGGT -30 This paper N/A R-50- AACTTACCTTCTACACTT AATCATAATTAA -30 This paper N/A Recombinant DNA pBluescript II KS(+) Stratagene Cat#212207 |